                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:52 nt.    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-16.50 kcal/mol
Antiterminator:    Distance from promoter:19 nt. Size=49 nt.     Delta G=-17.04 kcal/mol
Anti-antiterminator:    Distance from promoter:2 nt.    Size=39 nt.     Delta G=-16.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtat-taaaat. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtatctatgatggctaagtttaaaatgcatgtagagccacatagataaacactatgtggctttttatttaaggcactaaggccacatagttttacact
atgtggcttttttatatgaaaaatataaattaattagattggggttgtaaaaaATG

    CPE0042 Gene: brnQ     GI: 18309025     BI number: CPE0043     GOG: COG1114     Description: sodium-coupled branched-chain amino acid carrier protei            aa           t  g           t  g           t  c           a  a   a       t  c a  a      t  t t  c       ta a  a       ta gc        tg at        cg         t ta        gc       t  a at        gc       t  c cg        ta        ta at        gc        gc cg        ta        at cg        at        ta gc        ta        at at        cg        cg gt        at        at at       c  |       cg t  t       at        cg gt        at        gc ta        at        gt at        ta        at                         ttttatatgaaaaatataaattaattagattggggttgtaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1114 Branched-chain amino acid permeases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_perfringens                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:101 nt.    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-16.30 kcal/mol Antiterminator:    Distance from promoter:70 nt. Size=46 nt.     Delta G=-13.70 kcal/mol Anti-antiterminator:    Distance from promoter:44 nt.    Size=40 nt.     Delta G=-16.80 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttaact-tacctt. It has a score value of 64.93 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttaactagagcttcaaaattaaataccttttactttagctattatagttaagtttgcgtttatgatatataaaagattcatagatgcaaactaggtttgt atctatgatggctaagtttaaaatgcatgtagagccacatagataaacactatgtggctttttatttaaggcactaaggccacatagttttacactatgt ggcttttttatatgaaaaatataaattaattagattggggttgtaaaaaATG     CPE0042 Gene: brnQ     GI: 18309025     BI number: CPE0043     GOG: COG1114     Description: sodium-coupled branched-chain amino acid carrier protei             a           a  a           t  a           t  t            tg   a        gc t  g      |  a cg       |  t at       |  g at       |  t at       a  a        a cg       a  g      a  a gt        ta       t  c ta        cg       a  a at        gc        gc gc        gc        at at        ta        ta ta       a  |       at at        gc        cg cg        ta        at ta        at        cg |  t       ta        cg t  g       cg        gc a  g       ta        at gc        at        gt at        ta        at                         ttatttaaggcactaaggccacatagttttacactatgtggcttttttatatgaaaaatataaattaattagattggggttgtaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1114 Branched-chain amino acid permeases ... can be seen here     ..................................................................................................................