                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-16.00 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTATTCAGCTAGGCATAGAGAGGCAGTATCTTCAATGAATTCTTGTAAAAGCTGTTT
AAATTGCAATGAGTTTCATAGTGGAACTTGTGAAAAGGAAATGGAGAATAAATTCAAC
ATTTTACAGGATATGATTTAAtttatatttgaaagaccttaatcaatatttttttgatagaggtctttttttatttctaaaaagg
caatttataattatttttatttatttttgtatcaccaatgaagaaaatttattatatactaataaataaaataattgttcaagtaaaggaggggattacA
TG

    CPE0053 Gene: CPE0053     GI: 18309035     BI number: CPE0053     GOG: COG0075     Description: probable transaminas AA T  A AT AT GC                   t A  A                t  t G  A       TA       a  t GC       T  A      t  t TA       T  t       at AT        At        at A  |       Gt        cg A  |       Ta        ta G  |       At        at G  |       Ta       a  a A  |       At        tg A  |       Gt        ta AT        Gt        cg AT       A  g       cg GT       C  |       at TA       A  |       gc GC        Ta        at TA        Ta        at TG        Ta        at CG        Tg        gt                         tttatttctaaaaaggcaatttataattatttttatttatttttgtatcaccaatgaagaaaatttattatatactaataaataaaataattgttcaagtaaaggaggggattacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0075 Serine-pyruvate aminotransferase/archaeal aspartate aminotransferase ... can be seen here     ..................................................................................................................