                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:114 nt.    Distance to gene:56 nt.     Distance to run of Ts=1 nt.   Size=39 nt.     Delta G=-11.40 kcal/mol
Antiterminator:    Distance from promoter:84 nt. Size=44 nt.     Delta G= -3.70 kcal/mol
Anti-antiterminator:    Distance from promoter:50 nt.    Size=46 nt.     Delta G= -3.72 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-tataaa. It has a score value of 74.3 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatataagctctttttctatttataaagcttttgattttaaaatataaagaagtttttaattatgtagagtaagtatacataattaagcactattcaa
tgtttttatggtataatttttatgtttttgttttttataaataactactatagattatatattttttatggtttaaagtagtatattttaataatataga
tctaataaagttttatttattttaaataataaggagaagtaataATG

    CPE0058 --- CPE0059 --- dgk2 Gene: CPE0058     GI: 18309040     BI number: CPE0058     GOG: COG0738     Description: conserved hypothetical protein Gene: CPE0059     GI: 18309041     BI number: CPE0059     GOG: COG1670     Description: probable ribosomal-protein (S5)-alanine N-acetyltransferase Gene: dgk2     GI: 18309042     BI number: CPE0060     GOG: COG1428     Description: probable deoxyguanosine kinas   g t  t        t a  t      t  a a  t      t  t c  t       ta         t t  t       ta       t  t ta        ta       a  t at        gt       t  t tg        ta        at cg        ta        ta at       t  c       at |  a      t  t       tg c  t       ta        tg g  a       gc        at a  a      t  |       gt a  t       at        at t  t       ta        ta t  t      t  t      a  a at        ta        ta at        tg        cg ta        ta        at at        at        ta cg        at        cg at        ta        at                         atattttaataatatagatctaataaagttttatttattttaaataataaggagaagtaataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0738 Fucose permease ... can be seen here [J] COG1670 Acetyltransferases, including N-acetylases of ribosomal proteins ... can be seen here [F] COG1428 Deoxynucleoside kinases ... can be seen here     ..................................................................................................................