Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:104 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.70 kcal/mol
Antiterminator: Size=52 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=59 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gataaacatattttttataatcactataatattatctttctcacgcttcctaaatttattacatataaatacaaatcttcaaatgatattgtataaatat
agtgttgacttataaaaataaagaatatataatgtaatcataacatgttactgttaaatcaggcataagttctaatagacttatgcctgtttttttatat
ttgattctatatatagaaaggaagtgaatttcttaacttaatataataagtctgagaaaataaatatgtttggattatttaaaagaagaattaaaattaa
TTG

    CPE0075


Gene: CPE0075     GI: 18309057     BI number: CPE0075     GOG: COG2190     Description: hypothetical protei


 ta
t  t
c  a
a  a
g  a       tt
 ta       g  a
 ta       t  c
 gt        at
 ta        cg
g  a       at
a  a       at
t  g       ta
a  a      |  a
t  a      a  a
a  |      c  t
a  |      t  c
 at       a  a
 ta       a  g       aa
 at        tg       t  t
 ta        gc       c  a
 gt        ta        tg
 ta        at        ta
 ta       a  a       gc
 at       t  a       at
|  g      a  |       at
|  t      t  |       ta
|  a      a  |       at
 ta        tg        cg
 at        at        gc
 gc        at        gc
 ta        gc        at
 at        at        cg
                        tttttttatatttgattctatatatagaaaggaagtgaatttcttaacttaatataataagtctgagaaaataaatatgtttggattatttaaaagaagaattaaaattaaTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG2190 Phosphotransferase system IIA components ... can be seen here

    ..................................................................................................................