                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:7 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=80 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTGTTTATATAATAATATTCCAGTATATAGATTAGCCTTAGTTAAGGAAGGCCAAAT
AGTAAAGATATATGAGGGAGTATTAAATCCTTATATGAGAAGTACACTTATGAAGTTA
GAAAGAGGAAAAGGGCATAAGAAAAACAAAGTATGCAATATAGAGATGCTTAAAACAA
TAAATTAAgctttaaattttatgtgaattaacattaaaaaaatcataatgatatattaagaggaatatttatatactaaggacaaatttaatta
tatttagttcttagtatatttttttaggcagaATG

    CPE0105 Gene: CPE0105     GI: 18309087     BI number: CPE0105     GOG: -------     Description: hypothetical protei             a           t  a           a  t            cg            ta            at           a  a           a  t           a  a           a  |            at            at            ta            ta           |  g           |  a           a  g           c  g           a  a           a  a           t  t   A        ta A  T       at C  A       at A  A       gt A  A       ta AT        gt AT        ta TA        at        at TA        ta       a  t Cg       |  c      t  a Gc       |  t      t  t |  t      |  a       ta |  t      |  a       at |  t      |  g       at |  a      |  g       at T  a      |  a      |  a A  a      |  c       cg Gt        ta        at At        ta        gt Gt        ta        gc At        at        at Ta        at        at At        at        ta Tg        ta        cg At        ta        at                         atatttttttaggcagaATG     ..................................................................................................................