                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.50 kcal/mol
Antiterminator: Size=63 nt.     Delta G= -7.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGTATGGAACTTTGCTGATTTTGCTACAAGCCAAGGAATTATAAGAGTTCAAGGAAA
TAAAAAGGGTATATTTACTAGAGAAAGAAAGCCTAAAATGATAGCTCATTCTTTACGT
GAAAGATGGACAAATATACCGGAATTTGGATACAAAAAATAAaattttattagtttttattttaaaaat
taggtatgcattgtgtacctaatttttcttatgttataatggcatatactagtgtactagattttaaggtttagaagtaagttttttagacaaatataat
gggaggaattttaagATG

    CPE0148 Gene: CPE0148     GI: 18309130     BI number: CPE0148     GOG: COG1802     Description: probable transcriptional regulato at t  t t  a t  g t  t at at At At Ta At At At At A  a A  a C  | A  | T  | A  | G  | G  |        t Ta       a  t Ta        cg Ta        gt At        tg At        at G  a       ta G  |       gc Cg        gc Cg        at At        ta Ta        ta At        at Tg        at             tttcttatgttataatggcatatactagtgtactagattttaaggtttagaagtaagttttttagacaaatataatgggaggaattttaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1802 Transcriptional regulators ... can be seen here     ..................................................................................................................