                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=67 nt.     Delta G= -3.39 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATAGTAACATTATCGATGAAGTTGTATCAAAGCATATAAAAGCACCTGTTGAACAGT
GGAAGAAACTAATAAAAGAAGATCCTGAAATAGCTAATTTTATAATATTATAAgaaatatt
ataaagcatttatagagtataaaattataagtcatagcatgggaaaaagtcatatagtattaagattaatattatgtgacttttttattataaaaaaatt
taaatgttttcaaaaaagctgttgtaattcatatattaatatgctagtatacaagtatagtattgcaaggaggaatggaaaATG

    CPE0149 --- CPE0150 Gene: CPE0149     GI: 18309131     BI number: CPE0149     GOG: COG1028     Description: probable oxidoreductase Gene: CPE0150     GI: 18309132     BI number: CPE0150     GOG: COG0800     Description: 2-dehydro-3-deoxyphosphogluconate/4-hydroxy-2-ox oglutarate aldolas             t           a  a           t  a           g  a           a  a            gt            at            ta            at            ta            ta            tg            at AA       |  c T  g      |  a A  a      |  t Ta       |  a Ta       |  g At       |  c Ta       |  a At       |  t At       |  g Ta       |  g At       |  g       ga Ta       |  a      a  t Ta       |  a       at T  |      |  a       ta T  |      |  a       ta A  |      |  a       at A  |       cg        ta Ta        gt        gt Cg       a  c       at Gc       a  a       ta A  |       at        at Ta        ta        tg At        at        at At        ta        cg At        tg        ta |  a       at        gc Gt        ta        at Ta        at        at Cg        at        at                         tttattataaaaaaatttaaatgttttcaaaaaagctgttgtaattcatatattaatatgctagtatacaagtatagtattgcaaggaggaatggaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here [G] COG0800 2-keto-3-deoxy-6-phosphogluconate aldolase ... can be seen here     ..................................................................................................................