                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:136 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-15.00 kcal/mol
Antiterminator:    Distance from promoter:111 nt. Size=36 nt.     Delta G= -4.00 kcal/mol
Anti-antiterminator:    Distance from promoter:80 nt.    Size=49 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-taacat. It has a score value of 87.01 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacagtttttttaaaatactgtaacatacaaatacaaattgaaaattaagtgttaaaaagtaatgaattttaagaaataattagtaaatattaaaatg
ttatagaaacgttgatgtatattctgtatttgggcatctggaatatgctgagttagtgatgcaaccgactatatttataaaaagttataaatatagtcgg
ttttttattttccattttttaagagaggagggcttattttATG

    CPE0155 --- CPE0156 Gene: CPE0155     GI: 18309137     BI number: CPE0155     GOG: COG4932     Description: conserved hypothetical protein Gene: CPE0156     GI: 18309138     BI number: CPE0156     GOG: COG4932     Description: probable surface protei gg t  g t  c ta at t  c g  t       tg tg       a  c cg       g  a ta        ta        aa ta        gc       a  g at       a  c       at ta       t  g       at at        ta        ta tg        gc        at gc        at        ta |  t      g  |       ta |  g      t  |       ta |  a      c  |       at tg       g  |       ta at        ta        at gt        at        ta ta        ta        cg tg        at        at gt        at        gc cg        gt        cg                         gttttttattttccattttttaagagaggagggcttattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG4932 Predicted outer membrane protein ... can be seen here [M] COG4932 Predicted outer membrane protein ... can be seen here     ..................................................................................................................