                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:71 nt.    Distance to gene:140 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-15.00 kcal/mol
Antiterminator:    Distance from promoter:33 nt. Size=56 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -4.32 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGAAT-AATAAT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGAATATGATGTTCCATTAACAAATAATATAAATGTTTCAATATGGGGAACTACTTT
ATACCCTGGATCTAGTATTACTTACAATTAAactaaagtaaaaaactgattttagctaggctaaaatcagtttttta
tttcatattttagagttataataaagtaaatattagatttgttttggacatcactatacaataaatttggtttacatgtattagattcatatgaattaaa
aagtgtttatgaagccgagtttaataaaatttttattggaggaattaaaATG

    CPE0164 Gene: CPE0164     GI: 18309146     BI number: CPE0164     GOG: NOG14517     Description: conserved hypothetical protei            TA           T  A   C       A  a A  T      A  c T  T      C  t C  T      A  a A  A       Ta A  T       Ta G  A       Cg GC        At GC        Ta GC        Ta T  |      |  a A  |      |  a T  |      A  a A  |       Ta AT        Gc         a CG        At       t  g TG       T  |       cg TA        Cg        gc T  T       Ta        at G  C       At        ta T  T      |  t       ta A  A      |  t       ta A  |      |  t       ta A  |      |  a       at TG       |  g       gc AT        Gc        ta TA        Gt        cg AT        Ta        at AT        Cg        at TA        Cg        at                         tttatttcatattttagagttataataaagtaaatattagatttgttttggacatcactatacaataaatttggtttacatgtattagattcatatgaattaaaaagtgtttatgaagccgagtttaataaaatttttattggaggaattaaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_perfringens                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:70 nt.    Distance to gene:148 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-15.90 kcal/mol Antiterminator:    Distance from promoter:39 nt. Size=56 nt.     Delta G= -7.20 kcal/mol Anti-antiterminator:    Distance from promoter:5 nt.    Size=50 nt.     Delta G= -3.40 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: GTGAAT-AATAAT. It has a score value of 64.26 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GTGAATATGATGTTCCATTAACAAATAATATAAATGTTTCAATATGGGGAACTACTTT ATACCCTGGATCTAGTATTACTTACAATTAAactaaagtaaaaaactgattttagctaggctaaaatcagtttttta tttcatattttagagttataataaagtaaatattagatttgttttggacatcactatacaataaatttggtttacatgtattagattcatatgaattaaa aagtgtttatgaagccgagtttaataaaatttttattggaggaattaaaATG     CPE0164 Gene: CPE0164     GI: 18309146     BI number: CPE0164     GOG: NOG14517     Description: conserved hypothetical protei            aa           t  a           c  g           a  t           A  a           A  a AT        Ta T  A       Ta T  C       Aa T  C       Aa C  C       Cc AT        At TG       |  g CG       |  a A  A      T  t AT        Tt         a GC        Ct       t  g GT        At        cg G  A      T  |       gc G  |       Ta        at TG        Ag        ta AT        Tc        ta TA       |  t       ta AT       |  a       ta AT       |  g       at |  A      |  g       gc C  C      |         ta T  T       G        cg T  T       A        at TA        T        at GC        C        at TA        T        at                         ttatttcatattttagagttataataaagtaaatattagatttgttttggacatcactatacaataaatttggtttacatgtattagattcatatgaattaaaaagtgtttatgaagccgagtttaataaaatttttattggaggaattaaaATG     ..................................................................................................................