Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:33 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-15.50 kcal/mol
Antiterminator: Size=63 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTTTACACTTGCAGAGATTATATTTTTAAAATATTCAATGTATAAGAATGAGTTAGA
AAAAGAAGATAAAAATTAActtttaatatgtaatagtgagaattttcacagtaaatattaatagtaacagtaattagagaaaaata
actaaatatatgaattttattgaaggcgtttcataaggttgatattattttcttatagaggtattaaattacaaaatatattttaaataaggttgtacta
attgtacaaccttgtaatttttataagtagaatatttagagaggatatgaagttatATG

    CPE0198


Gene: CPE0198     GI: 18309180     BI number: CPE0198     GOG: -------     Description: hypothetical protei


           aa
          t  a
          t  t
           at
           ta
           gc
          |  a
          g  a
          a  a
          g  a
           at
           ta
           at
  c        ta
g  g      |  t
 gt       t  t
 at       c  t
 at       t  t
 gc        ta         a
t  |       ta       a  t
 ta        ta       t  t
 at        at        cg
 ta        ta        at
 ta        ta        ta
 tg       a  g       gc
 tg        tg        ta
 at        at        ta
 at        gt        gc
g  g       tg        gc
 ta       |  t       at
 at        ta        at
 ta        gc        tg
 at        gt        at
                        aatttttataagtagaatatttagagaggatatgaagttatATG


    ..................................................................................................................