Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:187 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGATATAGTACAGGTCCTCATGCTCACTTTGAAATAAGAATTAATGGACAACATGTA
AATCCTATGGATTATATCTAAtaaaaaagatagtcatttgactatctttttttatttacataattattgattaaattttaataga
ataaattaattcatcctatttttaattattaaagaggtatattattcattaaatacttgattttagtaaaaacataaaatataatgaaagcgttaacata
ttaataaccattttaatatgttatacatttttacgtaacaaatgaaaggatgagattATG

    CPE0201


Gene: CPE0201     GI: 18309183     BI number: CPE0201     GOG: COG2503     Description: probable acid phosphatas



 aa
t  a
A  a
A  a       tt
 Ta       a  t
 Cg        cg
 Ta        ta
 At        gc
 Ta        at
A  g       ta
T  |       at
T  |       gc
A  |       at
 Gt        at
 Gc        at
 Ta        at
 At        at
            ttatttacataattattgattaaattttaatagaataaattaattcatcctatttttaattattaaagaggtatattattcattaaatacttgattttagtaaaaacataaaatataatgaaagcgttaacatattaataaccattttaatatgttatacatttttacgtaacaaatgaaaggatgagattATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG2503 Predicted secreted acid phosphatase ... can be seen here

    ..................................................................................................................