                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -5.01 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTAATGGTTGTGTATATTTAGATGGTAGGTATGCAGGAATTTTAAAACCAAGTGGAGC
TATATATATAGAAGGAAGAAGAGGATTTATAAAGAAGAATGGAGATATTTATTTAGAT
GGTATATTAATTGGAACTTTAAATAATTATAGTATTGTATATTAAtattttaaaagttatgagatat
gtaattatttcataacttttttatattttaaatgttttaacctaaaaattaaaggtatataatataataaggaattcacaaaatatttataaaataactg
tgaatggaggtgttaccATG

    CPE0210 --- CPE0211 Gene: CPE0210     GI: 18309192     BI number: CPE0210     GOG: -------     Description: hypothetical protein Gene: CPE0211     GI: 18309193     BI number: CPE0211     GOG: COG0419     Description: conserved hypothetical protei   T A  A T  T GT TA TA At Ta Gt At T  t At Ta T  | A  | A  | T  | A  | A  | A  | Ta        ta Ta       g  a Ta       t  t Cg        at At        ta At        at G  a       gt Gt        at Tg        gc Ta        ta A  g       at A  a       ta T  t       ta Ta        gc At        at Tg        at At        at Ta        at             ttatattttaaatgttttaacctaaaaattaaaggtatataatataataaggaattcacaaaatatttataaaataactgtgaatggaggtgttaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0419 ATPase involved in DNA repair ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_perfringens                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:47 nt.    Distance to gene:97 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-10.00 kcal/mol Antiterminator:    Distance from promoter:12 nt. Size=68 nt.     Delta G= -5.01 kcal/mol Anti-antiterminator:   Size=68 nt.     Delta G= -6.62 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TGGAGA-TATATT. It has a score value of 62.92 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGGAGATATTTATTTAGATGGTATATTAATTGGAACTTTAAATAATTATAGTATTGTA TATTAAtattttaaaagttatgagatatgtaattatttcataacttttttatattttaaatgttttaacctaaaaattaaaggtatataatataat aaggaattcacaaaatatttataaaataactgtgaatggaggtgttaccATG     CPE0210 --- CPE0211 Gene: CPE0210     GI: 18309192     BI number: CPE0210     GOG: -------     Description: hypothetical protein Gene: CPE0211     GI: 18309193     BI number: CPE0211     GOG: COG0419     Description: conserved hypothetical protei             t           t  a           g  t AC        ag A  T       aa GT        ag GT        aa TA        tt TA        ta A  A       tt AT       t  g TA        at TA        ta |  T      A  | AT       A  | TA       T  | AT       T  | TA       A  | G  G      T  | GT       A  | TA        T AT        G GT        T |  G       T A  T       A        ta T  A       T       g  a T  T      G        t  t T  A       A        at A  T       T        ta T  T       A        at TA       T         gt TA       T         at At       A         gc Ta        A        ta At        T        at Gt        A        ta At        A        ta Gt        A        gc                         ttttttatattttaaatgttttaacctaaaaattaaaggtatataatataataaggaattcacaaaatatttataaaataactgtgaatggaggtgttaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0419 ATPase involved in DNA repair ... can be seen here     ..................................................................................................................