Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:143 nt.    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-17.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGT-AAAGAT. It has a score value of 65.6 and is shown in blue

TTGAGTTTAATGTAGAACTTTTAAAAGATACTAAAAAGTTTGTAAAAGACTTTACTGT
ATCAAGCTTACCACAGACTGGTTCACCAATAGGAGGAAACTCAGTTGCATTATTAGGA
ATGGCAATGATGGGAGCTTCTATGTTTATTAGAAAAAGAGAAGAGTAAaagcagtttagtttga
gaggatttcctctcaaactatttttaaacaaatggagggaaattagATG

    CPE0221 --- CPE0222 --- CPE0223 --- CPE0224 --- fhuC --- CPE0226 --- CPE0227 --- CPE0228 --- CPE0229


Gene: CPE0221     GI: 18309203     BI number: CPE0221     GOG: COG5386     Description: hypothetical protein
Gene: CPE0222     GI: 18309204     BI number: CPE0222     GOG: COG3764     Description: conserved hypothetical protein
Gene: CPE0223     GI: 18309205     BI number: CPE0223     GOG: COG0614     Description: ferrichrome ABC transporter
Gene: CPE0224     GI: 18309206     BI number: CPE0224     GOG: COG0609     Description: ferrichrome ABC transporter
Gene: fhuC     GI: 18309207     BI number: CPE0225     GOG: COG1120     Description: ferrichrome ABC transporter
Gene: CPE0226     GI: 18309208     BI number: CPE0226     GOG: COG4988     Description: probable ABC transporter
Gene: CPE0227     GI: 18309209     BI number: CPE0227     GOG: COG1132     Description: probable ABC transporter
Gene: CPE0228     GI: 18309210     BI number: CPE0228     GOG: COG2832     Description: hypothetical protein
Gene: CPE0229     GI: 18309211     BI number: CPE0229     GOG: NOG46811     Description: hypothetical protei


          tt
         a  t
          gc
          gc
          at
          gc
          at
          gc
          ta
          ta
          ta
          gc
          at
          ta
            tttttaaacaaatggagggaaattagATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG5386 Cell surface protein ... can be seen here
[M] COG3764 Sortase (surface protein transpeptidase) ... can be seen here
[P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here
[P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here
[PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here
[CO] COG4988 ABC-type transport system involved in cytochrome bd biosynthesis, ATPase and permease components ... can be seen here
[V] COG1132 ABC-type multidrug transport system, ATPase and permease components ... can be seen here
[S] COG2832 Uncharacterized protein conserved in bacteria ... can be seen here

    ..................................................................................................................