                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:124 nt.    Distance to gene:87 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G= -8.60 kcal/mol
Antiterminator:    Distance from promoter:68 nt. Size=71 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:    Distance from promoter:31 nt.    Size=59 nt.     Delta G=-18.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaat-tactgt. It has a score value of 76.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaatttttaaccagaatatgatactgtctacatatagtaaatacttatagcgtgttagtatttattttggatttggttggagaataatttcttcagcc
tttattctttatatagatagtttatagtttaagaaatatttaaaattaagtcttatgaaatcaagggtaacttgagtattcataaggcttttttatttta
tttattatggaaattcattataaaaacctatttgtaatcatatatttcatataaagattaattaataggggaggagaattttttataATG

    CPE0240 --- CPE0241 Gene: CPE0240     GI: 18309222     BI number: CPE0240     GOG: NOG05054     Description: hypothetical protein Gene: CPE0241     GI: 18309223     BI number: CPE0241     GOG: COG2885     Description: hypothetical protei             a           a  t           a  a            gt            at            at            ta            ta aa        ta t  t      g  a at       a  t at       t  | gc        at at        ta gt        ta gc       t  | ta       g  | tg       a  | gc        tg gc        at |  t       gc t  t       at t  t      t  |        t ta        at       g  a at        ta       g  a gt        at        gc gc        tg        at |  t       ta        at |  t       ta        cg t  t      c  a       ta t  a      t  t      |  g t  t      t  c      |  t ta       a  |      a  a at        ta        at ta        ta        at tg        tg        gc ta        cg        ta at        cg        at ta        gt        ta                         aggcttttttattttatttattatggaaattcattataaaaacctatttgtaatcatatatttcatataaagattaattaataggggaggagaattttttataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2885 Outer membrane protein and related peptidoglycan-associated (lipo)proteins ... can be seen here     ..................................................................................................................