Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:201 nt.    Distance to gene:13 nt.     Distance to run of Ts=2 nt.   Size=30 nt.     Delta G= -9.20 kcal/mol
Antiterminator:    Distance from promoter:168 nt. Size=36 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:    Distance from promoter:115 nt.    Size=72 nt.     Delta G= -4.12 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGT-tgtatt. It has a score value of 68.94 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGTTTATAAattaatttagctgtattaaatatattctaaaaaataaatttcttagaatatattttgatacagctatttgttttttatg
aagataatatttcctatgaaatatatgtatgtagaatgtattatttggttttgtattatggtaaaatattcatgtaaaaaatagaaagttaagagtagat
tagtaaagggttttatattatagtaaaaattatttaaaccctatagaggaagatagatttccttttaggtatttattttaaggaggaaagcaATG

    CPE0250


Gene: CPE0250     GI: 18309232     BI number: CPE0250     GOG: COG4464     Description: capsular polysaccharide biosynthesis protei


 tt
g  a
a  a
a  g
a  a
g  g
a  t
t  a
a  g
a  a
a  t
a  t
a  a
a  g
t  t
g  a
t  a       aa
a  a      a  a
 cg        ta
 tg        gt
 tg        at         a
 at        ta       t  g
t  t       at       a  a
 at       t  t       gt
 at       t  t       at
a  a      a  |       at
 at       t  |       gc
 ta       a  |       gc
 gt       t  |       at
 gt        ta        gt
 ta        ta        at
 at        ta       t  |
 ta        gc        at
 tg        gc        ta
 at        gc        cg
 ta        at        cg
                        tatttattttaaggaggaaagcaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[GM] COG4464 Capsular polysaccharide biosynthesis protein ... can be seen here

    ..................................................................................................................