                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:71 nt.    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-17.70 kcal/mol
Antiterminator:    Distance from promoter:53 nt. Size=35 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:    Distance from promoter:8 nt.    Size=53 nt.     Delta G=-11.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCTT-TAGTTT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCTTTAGAAACACAAGAAGACGTAGTTTCATTTGAGGTTAAAAATGAAGGAGAGTC
TGAAGGTTTTGTATTCTTAGATTCTACATGGACATAAaaaatagaggatatgaccatagtttatatggcttat
atcctcttttgtgtactaattatgtgaaaagatgttaataatgaaaaatattaaagtcttttgataaggagaattcttATG

    CPE0274 Gene: CPE0274     GI: 18309256     BI number: CPE0274     GOG: COG0438     Description: hypothetical protei   T T  G T  T TA GT G  T A  C AT GT TA CG TA                   t GT        ta       t  t AT       a  g      g  a GC       a  a       at AT       a  g       ta G  A      a  g       at G  |      A  a       cg A  |       At        cg A  |       Ta       |  c GC        At        at TA        Cg        gt AT       A  a       ta A  G       Gc        at A  |       Gc        ta A  |       Ta        at A  |       At        gc TG       |  a       gc TA        Cg        at GC        At        gc                         ttttgtgtactaattatgtgaaaagatgttaataatgaaaaatattaaagtcttttgataaggagaattcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0438 Glycosyltransferase ... can be seen here     ..................................................................................................................