Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:120 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-18.20 kcal/mol

                                                                        Nomenclature/Definitions

TACTAATGGTGTAGGACACGTTGGAATATATGTAGGTGGTGGAAACATGATTCACGCT
GCTAGACCAGGTGTTGGTGTAATAGTAGGCCCTATATATAATTTCTCATCAGCAAGAA
GAATATTATAAtttaaaatatatttatgccaaacagtagaaatagctgtttggcatatttttttataaaaggttaagaattttgagtatatg
ctataatatagactataacaattaaagagaccttaatttatttactgattttacaggtctactgattacaataaaggtgagtgtgaagaagtATG

    CPE0279 --- CPE0280


Gene: CPE0279     GI: 18309261     BI number: CPE0279     GOG: COG4123     Description: conserved hypothetical protein
Gene: CPE0280     GI: 18309262     BI number: CPE0280     GOG: COG0313     Description: conserved hypothetical protei


          aa
         g  a
          at
          ta
         |  g
          gc
          at
          cg
          at
          at
          at
          cg
          cg
          gc
          ta
          at
          ta
            tttttttataaaaggttaagaattttgagtatatgctataatatagactataacaattaaagagaccttaatttatttactgattttacaggtctactgattacaataaaggtgagtgtgaagaagtATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG4123 Predicted O-methyltransferase ... can be seen here
[R] COG0313 Predicted methyltransferases ... can be seen here

    ..................................................................................................................