Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-18.30 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -4.01 kcal/mol
Anti-antiterminator:   Size=76 nt.     Delta G= -9.65 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCTAAAATACTTAGTATTGCTACTTCTGTAGCCTCAACTGGTATTCCACCAGTTGAA
AATATGCGTTTCCCTCTAGATGGATATTGTAAAGGTGAAATGATTGATGGCGTTTGGT
ACTTAACATTTGATGAAGCTAAAACAAAGGAACAAATACAAGACTATATCTATAAGGA
TGTTAATCCAAAATAAtatattaactagctggaaaataatcttaaaagattgtttttcagcttttttactatagagaattaatgatat
aattattttaaaatatactactctgaaaggatgagattATG

    CPE0283


Gene: CPE0283     GI: 18309265     BI number: CPE0283     GOG: COG2017     Description: conserved hypothetical protei


 GA
G  A
A  C
A  A
A  A
C  A
A  T
A  A
A  C
A  A
 TA
 CG
|  A
 GC
 AT
A  A
 GT
 TA
 AT         a
 GC       t  t
|  T      a  t
|  A      t  a
|  T      A  a
|  A      A  c
|  A      T  t       aa
 TG       A  a      t  a
 TG       A  g       ta
 TA       A  c       cg
 AT        At        ta
 CG        Cg        at
 AT        Cg        at
 AT        Ta        tg
 TA       A  a       at
 TA       A  a       at
C  T      T  a       at
A  |      T  t       at
T  |      G  a       gt
 GC        Ta        gc
 GC        At        ta
 TA        Gc        cg
 TA        Gt        gc
 TA        At        at
                        tttttactatagagaattaatgatataattattttaaaatatactactctgaaaggatgagattATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG2017 Galactose mutarotase and related enzymes ... can be seen here

    ..................................................................................................................