                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:82 nt.    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-10.10 kcal/mol
Antiterminator:    Distance from promoter:19 nt. Size=74 nt.     Delta G= -6.00 kcal/mol
Anti-antiterminator:    Distance from promoter:1 nt.    Size=50 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: gtgaat-tataat. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtgaattttaacctattataagcctatataataactgtaaaaattgactaaaatatctaaaaggtataaggttaaattagggtataaaaagagactttta
gtaataaatatcaatatagcatattaaataatatgctatattttataaaagaaaattggtcataccaaaattttttatggtataaagttattatgagggg
tgaaagaaTTG

    CPE0310 Gene: CPE0310     GI: 18309292     BI number: CPE0310     GOG: COG1620     Description: probable lactate permeas            aa           a  a           a  g           t  a           a  g            ta            gc            gt            gt            at           t  t           t  a   a       a  g a  a      a  | t  a       at cg        ta tg        ta at        gt ta       g  a at       a  a a  a      a  | a  a       ta a  |       at tg        ta cg        gt at        gc gt       |  a       aa ta       a  a      a  t ta       a  t       ta a  a      a  a       ta a  |       at        at a  |       ta        ta at        cg        at at       |  c       cg ta        ta        gc g  g       at        at tg        ta        ta cg        at        at at        at        ta                         ttttataaaagaaaattggtcataccaaaattttttatggtataaagttattatgaggggtgaaagaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1620 L-lactate permease ... can be seen here     ..................................................................................................................