                                                                        Gene putatively regulated by attenuation in C_perfringens

This operon is putativelly rgulated by Guanine_G-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:181 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=76 nt.     Delta G=-15.95 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tgggttgagtgtttctactaggaggccgtaaacatcctaactacgaatatataggtgatttctatatttttttgtgagattattatatattcctaggctt
tttggcttaggaatttttttaattcatataaaattattatgtaaaagctttaattaagctttctttttaatatgctctatagaaattatctttgtagtaa
agtaggcctctacatagagctttaatagattcaattagaaaattctaaacggagttatttattataatgaaataatttttatagcagggggaaaaggaag
ATG

    xpt Gene: xpt     GI: 18309317     BI number: CPE0335     GOG: COG0503     Description: xanthine phosphoribosyltransferas tt t  t t  t at tg at t  | cg ta tg ta at gt ta g  | gt at ta at ta at ta at at gc c  c a  t t  a c  | a  | a  | t  | c  | c  |       tt t  |      t  t a  |       tg c  |       cg a  |       gc a  |       gt a  |       at t  |       ta g  |       cg cg        cg cg        ta gc        ta gt        at             ttttttaattcatataaaattattatgtaaaagctttaattaagctttctttttaatatgctctatagaaattatctttgtagtaaagtaggcctctacatagagctttaatagattcaattagaaaattctaaacggagttatttattataatgaaataatttttatagcagggggaaaaggaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0503 Adenine/guanine phosphoribosyltransferases and related PRPP-binding proteins ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................