                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:153 nt.    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-10.00 kcal/mol
Antiterminator:    Distance from promoter:127 nt. Size=42 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGACT-TATATT. It has a score value of 71.62 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGACTTCAAATAAAACAGTGTTTCATATATTAAAAAAGGCTGATTTTGAAGTGTTTT
ATTTGGATTATTCAGAGATTTTAAAAGCTGGTGGAGGATTTACATGTAGTACTTTATA
TTTTTATATTGAATAAtttttactgagatttatttcttattaagaatcatgttattatgatatagtgtttttatctgatgaattcttt
agtcattagataaattttttaaaataaaatatatgaattagggggagattttTTG

    CPE0345 Gene: CPE0345     GI: 18309327     BI number: CPE0345     GOG: COG0534     Description: conserved hypothetical protei   g t  t g  t a  t t  t at ta at         t gc       c  t t  |      t  t at       t  a tg       a  g ta        at at        gc tg        ta ta        at g  |       gt t  |       ta a  |       cg c  |       ta ta        at at        ta at        ta gc        ta             ttttttaaaataaaatatatgaattagggggagattttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG0534 Na+-driven multidrug efflux pump ... can be seen here     ..................................................................................................................