Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-19.20 kcal/mol
Antiterminator:    Distance from promoter:47 nt. Size=60 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:    Distance from promoter:1 nt.    Size=54 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAAAG-TAGAGT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAAAGCCATCTTTGGATTGCCTAGAGTTTTATCAAAGGTTTGGGTGGTTAATTTAAC
TAAAGACATAGAAATAAGTGGGTAAtaatattttaaaaatagaaagtatattaatttagttaagaggttacattcatattaa
gtgagtgtaacctttttattttaggatatatttattagtaatattaagattttatccttgactctaacattgtgttagggagtaatataaattccaggag
ggagttatATG

    CPE0346


Gene: CPE0346     GI: 18309328     BI number: CPE0346     GOG: COG0789     Description: probable transcriptional regulato


            t
          a  a
          t  t
          g  t
          a  a
  T       a  a
T  A       at
T  A       gt
A  C       at
 AT        ta
 TA       a  g
 TA       a  |
|  A      a  |
|  G       at
G  A       at
 GC        ta         t
 TA        ta       t  a
 GT        tg       a  a
G  A       ta        tg
G  G      a  g       at
 TA       t  |       cg
 TA       a  |       ta
 TA       a  |       tg
 GT        tg        at
|  A       At        cg
G  A       At        at
A  G       Ta        ta
A  T       Gc        ta
A  G      |  a       gc
 CG       |  t       gc
 TG       G  t       at
 AT        Gc        gt
 TA        Ta        at
 TA        Gt        at
                        tattttaggatatatttattagtaatattaagattttatccttgactctaacattgtgttagggagtaatataaattccaggagggagttatATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG0789 Predicted transcriptional regulators ... can be seen here

    ..................................................................................................................