                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.90 kcal/mol
Antiterminator: Size=61 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTTTTATGTGTTTAAAGAAAATTTTTGGGGAGGTGGAAGTGTTAGTAACTTCTCTCC
TATTATGAAATTTACTTTATTTGAACGTTTTTCAGAAAAACAATTAGAGGTATCTGAA
ACTATAGAGGTCAATGGAAAAAGAACCTTTGGATATGATGACCCTATTATTTATAAAA
GAAAATAAttaattttatagtaagtacatgtcttaattgatatgtacttttttaatatccattttatgaaaaaatataaagttaatgttataat
ttattaatagaaatcaaaagggggagattcttTTG

    CPE0377 Gene: CPE0377     GI: 18309359     BI number: CPE0377     GOG: COG1309     Description: probable transcriptional regulato            TA           A  A           A  t           A  t           A  a           G  a            At            At            At            At   A        Ta A  C       At GC       T  | AT        Ta AT        Tg AT        At A  G       Ta A  G       Ta G  A      A  | GT       T  | TA       C  | AT       C  |       aa |  G       Cg       t  t |  A       At       t  t AT       G  a       cg CG       T  |       ta TA       A  |       gt GC        Gc        ta GC        Ta        at A  |       At        cg GC        Tg        at AT        At        ta TA        Gc        gc AT        Gt        at                         tttttaatatccattttatgaaaaaatataaagttaatgttataatttattaatagaaatcaaaagggggagattcttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1309 Transcriptional regulator ... can be seen here     ..................................................................................................................