                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:143 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=57 nt.     Delta G= -3.15 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATACTCATTGTAATAACTTTTGGTCTATATGGGCTTGTAGTAAAGATTAGATTTCAA
CAATGGACAAGTGCAAATACAATTTTTGAAGATGTGGAAATAAAATAAaaagagctaaagccta
aaagcatagaattttcaataatttctatgttttttatataatcaatttatttttattattaaatatataagtaaaaaattattgtaattataaaaaacaa
gtatttaacttatttagggtgtagatttataataaaaatgcagaaagaaataatatacaaaagaaagaagtgtttagtATG

    CPE0408 Gene: CPE0408     GI: 18309390     BI number: CPE0408     GOG: COG0561     Description: conserved hypothetical protei aa t  a c  a cg gc a  a a  | at ta cg g  a a  | g  | a  | a  | a  | A  | A  | T  | A  | A  | A  | A  | T  | A  |        a A  |      c  a A  |      t  t G  |       ta G  |       ta T  |      t  t G  |       at Ta        at At        gc Gt        at At        ta At        at Gc        cg Ta        gt Ta        at             ttttatataatcaatttatttttattattaaatatataagtaaaaaattattgtaattataaaaaacaagtatttaacttatttagggtgtagatttataataaaaatgcagaaagaaataatatacaaaagaaagaagtgtttagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0561 Predicted hydrolases of the HAD superfamily ... can be seen here     ..................................................................................................................