                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=57 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAATGGCTTCATGGATTTGGATGTGTAGAGGAATCTGTAAAAGAAAGTGTAACATCA
TTAAAAAATCATCCCTTAATGCCTAGTGATGTAAATGTGCATGGACTTGTAATTGATC
CACACACAGGAGAACTTAAGGTTATAGTAAATGGATACGAATAAaataaaaattaaaaaacacttac
tttaatttatttaaagcaagtgtttttttggagggttaattaatacttaatatcattgatacataaattttttatgaaagttatattattatataaatta
atatagggggagatagtATG

    CPE0414 --- CPE0415 Gene: CPE0414     GI: 18309396     BI number: CPE0414     GOG: COG4905     Description: hypothetical protein Gene: CPE0415     GI: 18309397     BI number: CPE0415     GOG: NOG46434     Description: hypothetical protei             t           a  a           a  a           A  a   A       A  a T  A       Ta T  G       At CG        At AT       G  a AT       C  a G  A      A  a A  T      T  a G  A      A  a        t G  |      G  a      t  a A  |       Gc       t  t CG        Ta        at AT       A  c       at C  A       At        ta A  A       At        ta C  A       Ta        ta AT        Gc        cg CG        At       a  c CG       T  t       ta TA        At        ta AT        Ta        cg |  A       Ta        at GC        Gt        cg TG        Gt        at TA        At        at                         tttttggagggttaattaatacttaatatcattgatacataaattttttatgaaagttatattattatataaattaatatagggggagatagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4905 Predicted membrane protein ... can be seen here     ..................................................................................................................