                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:81 nt.    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -9.00 kcal/mol
Antiterminator:    Distance from promoter:50 nt. Size=44 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:    Distance from promoter:29 nt.    Size=45 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-tggaat. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgataacagcttgaataagctggaatcttagaattgatagccaataggaaaaatagagacttaattcaaaggagcttagcaaactttggattttagcct
tattttaaaatctgttttttaggtgattctaaaaaacaaatttttttgaattttgggcgaacgtttgcacaaagttcgaatttaaaattcaattaatata
cgtaaacataaggagaaaatATG

    CPE0418 Gene: CPE0418     GI: 18309400     BI number: CPE0418     GOG: COG0366     Description: exo-alpha-1,4-glucosidas   t         t t  a      t  a cg       c  t gc       c  t |  a       gt a  a       at g  a       ta gc        ta        ga at        ta       t  t at        ta        gt at        at        gc cg        gc        at tg        gt        ta ta       t  |       ta at       t  |       ta at       t  |       ta |  t       cg        ta t  t       at        ta ta        at        gc cg        at        ta a  c      c  t      c  a gc        gt        ta at        at        at gt        ta        at                         tttttgaattttgggcgaacgtttgcacaaagttcgaatttaaaattcaattaatatacgtaaacataaggagaaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0366 Glycosidases ... can be seen here     ..................................................................................................................