                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:87 nt.    Distance to gene:135 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -7.00 kcal/mol
Antiterminator:    Distance from promoter:55 nt. Size=45 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:    Distance from promoter:4 nt.    Size=65 nt.     Delta G= -6.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: GTGCAA-TATAAT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGCAAAGAAAAGATTAGTCATAACTTATAATTCTCAAGGAAAATATGGACATAGAAA
TGAAATAAGCCAGTTCATAAATTATATTCCAAAGGAGTTCTTTAAAATTATATAAtttt
tataatagacttttgtttaaaggtttgttgatttttttagatgaaagattattttaagaggtaattagggattatatataaattttagaaggttaggaaa
agcctaaggttgatatacttcatataaatctgtataataattctgaaactaaaggatggagtggattttaagATG

    CPE0424 Gene: CPE0424     GI: 18309406     BI number: CPE0424     GOG: COG0220     Description: conserved hypothetical protei   G A  C A  C T  A A  G AT AT GC TA         t AT       A  t |  A      A  t A  A      T  t A  A       At GT        Ta AT        At TA        Ta AT        Ta |  A       At C  T      A  | AT       A  | GC       A  | GC       T  |       tt TA       T  |      g  t |  A       Ta        ta |  A       Cg        ta A  G       Ta        ta T  G      T  |       tg A  A      G  |       cg A  G      A  |       at AT        Gc        gt AT        Gt        at GC        At        tg GT        At        at AT        At        at AT        Cg        tg                         atttttttagatgaaagattattttaagaggtaattagggattatatataaattttagaaggttaggaaaagcctaaggttgatatacttcatataaatctgtataataattctgaaactaaaggatggagtggattttaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0220 Predicted S-adenosylmethionine-dependent methyltransferase ... can be seen here     ..................................................................................................................