Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:218 nt.    Distance to gene:7 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-14.10 kcal/mol
Antiterminator:    Distance from promoter:160 nt. Size=71 nt.     Delta G= -7.61 kcal/mol
Anti-antiterminator:    Distance from promoter:143 nt.    Size=30 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaga-tatatt. It has a score value of 70.28 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgagaaaacttgtaccgttgggtatattgaccaagaagcttccacttctataagtggagagtagttcacttgtgaaatatagaaaagaaagcttaaata
aaaacttcctttatttataggaattagaatcaaaaaatgtttaatttttgaaaaaatacttgaataataagtaacagtatgttaatataatattaacagg
ttaaagcataaacctaatttccctatatttcatatatatatgcatttgtcctataagtatcccttagcttataggactttttgttatataTTG

    CPE0429


Gene: CPE0429     GI: 18309411     BI number: CPE0429     GOG: -------     Description: hypothetical protei


            c
          t  a
          t  t
           ta
           at
           ta
           at
           ta
          c  |
          c  |
          c  |
          t  |
          t  |
          t  |
          a  |
          a  |
          t  |
          c  |
          c  |
          a  |
          a  |
           at
           ta
           at
           cg
           gc
  a       |  a
t  a       at
 at        at        cc
 ta        at       c  t
 at        tg       t  t
 at       t  t      a  a
 ta        gc        tg
 ta        gc        gc
 gc        at        at
 ta       c  a       at
a  g      a  t       ta
t  |      a  a       at
g  |       ta        ta
a  |       tg        cg
 cg        at        cg
 at        ta        ta
 at        at        gc
                        tttttgttatataTTG


    ..................................................................................................................