                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:161 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=71 nt.     Delta G= -3.92 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G= -4.72 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaaaagtatataaaaatcagtttacctaaaattttagaagttaaaaataagtccttttaagattactaactaaaatcaaaaaaatattaagaaactcttt
agaaaatctttagatttatctgaggagtttctttatttttaaagtttattataagagtgtagcaaatgagaagaaagcaattaacaatttagataataga
aattcccttgaaaattaagttagattaggaggggaagttaaaatcaaaaattaataaaaatatagattaaataaaattttaaaattgaaaggtaaggggt
ATG

    CPE0455 Gene: CPE0455     GI: 18309437     BI number: CPE0455     GOG: COG0586     Description: alkaline phosphatase-like protei             a           a  t           a  a           a  t           a  t           a  a           a  a            cg            ta           a  a           a  a           a  c           a  t           t  c           c  t            at            at            ta            cg           |  a   a       a  a a  t       ta a  a       ta        tt a  a       at       t  a a  g       gc        at t  t       at        gc t  c       at        at gc       t  t       tg at       t  a       ta at       t  |       tg gt       t  |       cg at       c  |       ta ta        cg       a  g ta        ta        at tg        gt        at ta        at        at at        at        gc at        ta        at                         ttatttttaaagtttattataagagtgtagcaaatgagaagaaagcaattaacaatttagataatagaaattcccttgaaaattaagttagattaggaggggaagttaaaatcaaaaattaataaaaatatagattaaataaaattttaaaattgaaaggtaaggggtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0586 Uncharacterized membrane-associated protein ... can be seen here     ..................................................................................................................