                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:116 nt.    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-22.40 kcal/mol
Antiterminator:    Distance from promoter:88 nt. Size=41 nt.     Delta G=-10.30 kcal/mol
Anti-antiterminator:    Distance from promoter:63 nt.    Size=43 nt.     Delta G=-14.21 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatt-taaagt. It has a score value of 84.34 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatttatgcaaatatttatgataaagttttaaagtatttaacaaactttgtttccatatgagggagtagttagctcaagttgaatgagtgattaagtc
aacaaattgaccaaagagctttggtctggcttaatcttaaatagcgagacttatatgcagttttttgctgcatataggtctttttttataaagtttttat
aagtaggaggatatattATG

    CPE0535 Gene: CPE0535     GI: 18309517     BI number: CPE0535     GOG: COG1971     Description: conserved hypothetical protei ag g  c at at         t at       c  t cg       t  a cg       a  a        t at       a  a      t  t gc       t  t      t  t t  |       ta        tg t  |       cg        gc a  |       gc        at a  |      g  g       cg a  |       ta        gc c  |       cg        ta a  |       ta        at at        gc        ta cg        gt        at tg       |  t       ta gc       |  a       tg at       t  t       cg at       t  a       at ta       t  t       gc ta        cg        at at        gc        gt                         tttttataaagtttttataagtaggaggatatattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1971 Predicted membrane protein ... can be seen here     ..................................................................................................................