Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:89 nt.    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -9.80 kcal/mol
Antiterminator:    Distance from promoter:32 nt. Size=70 nt.     Delta G= -4.89 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ataaat-taaaat. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ataaatttgaaaataaaacatattaaaattaattaaataattaatgaatatgttttctgtttgagtatatagttataaaatacttgttaaaaataatttt
atattaaaaatcaacctttgcaatatatttatattaaaaaaatatattgcatttttattcattaataatgtataattattcaagaagagagcaataagcg
aataaatattagggggaatatatATG

    CPE0596 --- sipS_lrep_2 --- ftsH


Gene: CPE0600     GI: 18309582     BI number: CPE0600     GOG: COG0834     Description: probable amino acid ABC transporter
Gene: CPE0601     GI: 18309583     BI number: CPE0601     GOG: COG0765     Description: probable amino acid ABC transporter
Gene: CPE0602     GI: 18309584     BI number: CPE0602     GOG: COG1126     Description: probable amino acid ABC transporte


           ta
          t  a
          g  a
           ta
           ta
          c  t
          a  a
           ta
           at
           at
           at
           at
           ta
           at
           ta
          |  t
          |  t
          |  a
          |  a
 tg       |  a
a  t      |  a
t  t      |  a
 at       |  t
 at       |  c
 gc       |  a
|  t      |  a
|  g      |  c        t
t  t      |  c      t  a
 at       |  t      a  a
 at       |  t      t  a
 tg       |  t      a  a
 ta        tg        ta
a  g       gc        ta
 at       a  a       ta
 ta        ta        at
 at        at        ta
a  a       ta        at
 at        at        ta
 ta        ta        at
 tg        gt        at
 at        at        cg
 at        gt        gc
 ta        ta        ta
                        tttttattcattaataatgtataattattcaagaagagagcaataagcgaataaatattagggggaatatatATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here
[E] COG0765 ABC-type amino acid transport system, permease component ... can be seen here
[E] COG1126 ABC-type polar amino acid transport system, ATPase component ... can be seen here

    ..................................................................................................................