                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGAAATTCTAAATCTTGCAAAAATAGTTGCTTCTATGGGTGGTTCTGGCTTAGAACA
AGAAAGATATCCTATGGATCAGTATTCTAAAGGTGAAATGATAAATGGTGTTTATTAT
TTAGCATTTGATAAAGATGTTACAGTTAAGCAAATTCATGATTATATTTTTGAAGATA
AAAAATAAaattttttatatacttctatatatttatagaagtattatttttgcttaatactattgatttaaattaaaatatactttttttaatt
ctataatattgatataaaaattggaggttattATG

    CPE0630 Gene: CPE0630     GI: 18309612     BI number: CPE0630     GOG: COG5263     Description: hypothetical protei   A A  a Ta At At At At At At Ta At |  a |  t |  a Gc        at At       t  t At        at Gc        ta T  t       at T  |       ta T  |       cg T  |       ta Ta        ta At        cg Ta        at At        ta Ta        at             tatttttgcttaatactattgatttaaattaaaatatactttttttaattctataatattgatataaaaattggaggttattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG5263 FOG: Glucan-binding domain (YG repeat) ... can be seen here     ..................................................................................................................