Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:128 nt.    Distance to gene:58 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.60 kcal/mol
Antiterminator:    Distance from promoter:81 nt. Size=59 nt.     Delta G= -8.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGATA-GATCAT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGATATTTAGAGAGAATAGGTGATCATATAACTAATGTTTGTGAAAATATAGTCTAT
GCCATAAAAGGTGATATGACTGAACTTGGATAAtaacataaaatataaataagataaaatttagcttattaggtct
gacttaattagtataataatttaaagatatatctataagtggtatatctttttttgttttcaatattgtgataagctataaaatagggtagtgttttggg
taaaggagggacaagaATG

    CPE0642


Gene: CPE0642     GI: 18309624     BI number: CPE0642     GOG: COG0745     Description: two-component response regulato



  t
t  a
c  a
 at
 gt
 ta
 cg
t  t
g  a
g  |
 at
 ta
 ta
 at
 ta
 ta
c  t        a
 gt       t  a
 at       a  g
 ta       t  t
 ta        cg
 ta        tg
|  g       at
a  a       ta
a  t       at
a  a       ta
 at        at
 ta        gc
 at        at
 gc        at
 at        at
            ttttgttttcaatattgtgataagctataaaatagggtagtgttttgggtaaaggagggacaagaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here

    ..................................................................................................................