                                                                        Gene putatively regulated by attenuation in C_perfringens

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-13.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-11.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaattgaaaaaaattgatagtataatttagaaaaaagtgaatatttaatcgtaagtgctaggggtgcatttttatatgctgagaggataatatctaaccc
ttaaaacctgatgtagttagtactaccgtagggaagcaaaagctattgtttatttatatttatgctttaaaaaggtataaatgtatctatataagtgttt
attaagcttgccttagggcaagcttttattttttataaaaaaataggatcctatattaatttaactgcgcagttaaaaaattaaaataaggagaactaat
ATG

    thiC Gene: thiC     GI: 18309661     BI number: CPE0679     GOG: COG0422     Description: thiamin biosynthesis protei   a a  a ta ta        ta tg       a  a cg        tg gt        at ta        tg at       c  t ta       t  t ta        at ta        ta at        gt tg       |  t at       t  a       ta ta       a  a      t  g t  t      a  g       cg t  c      a  c       cg at       t  t       gc ta        at        ta t  t       tg        ta ta        gc        cg gt        gc        gc ta        at        at ta        at        at                         ttattttttataaaaaaataggatcctatattaatttaactgcgcagttaaaaaattaaaataaggagaactaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0422 Thiamine biosynthesis protein ThiC ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_perfringens This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-11.40 kcal/mol Antiterminator: Size=43 nt.     Delta G= -4.80 kcal/mol Anti-antiterminator:   Size=31 nt.     Delta G= -9.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case aaattgaaaaaaattgatagtataatttagaaaaaagtgaatatttaatcgtaagtgctaggggtgcatttttatatgctgagaggataatatctaaccc ttaaaacctgatgtagttagtactaccgtagggaagcaaaagctattgtttatttatatttatgctttaaaaaggtataaatgtatctatataagtgttt attaagcttgccttagggcaagcttttattttttataaaaaaataggatcctatattaatttaactgcgcagttaaaaaattaaaataaggagaactaat ATG     thiC Gene: thiC     GI: 18309661     BI number: CPE0679     GOG: COG0422     Description: thiamin biosynthesis protei            ct           t  a            at            ta            gt           t  a   a       a  a a  a       ag ta        at ta        tg tg       |  t cg       a  t gt       t  t ta       g  a       ta at       g  t      t  g ta       a  t       cg ta        aa        cg ta        aa        gc at        ag        ta tg        ac        ta at        tt        cg ta        tt        gc                         ttttattttttataaaaaaataggatcctatattaatttaactgcgcagttaaaaaattaaaataaggagaactaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0422 Thiamine biosynthesis protein ThiC ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................