                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-10.40 kcal/mol
Antiterminator: Size=70 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTTATTTAAGATATTCTTTAGGACTACTTTTTAATGGTAATAATAAAGATACAATTG
ATGACTTAAGCCAATATAATAGTTTAGAAATAATTCAAATGTATAGATATTATCTTCA
TCAAATAACTCTTAAAAAGTTAGAGAAAAGTTTAAAGTCAGATAAAGTTAATAGTTAA
tataaaaagaagttgtattcttatttagaatacagcttttttttattatgtttttgtgaattataccataaagtattctatactatagagtactttgtgg
tataattatacttgggagggataataTTG

    CPE0704 --- CPE0705 Gene: CPE0704     GI: 18309686     BI number: CPE0704     GOG: COG1695     Description: 30S ribosomal protein homolog Gene: CPE0705     GI: 18309687     BI number: CPE0705     GOG: -------     Description: hypothetical protei TC G  A A  G A  A AT TA TA TA G  G AT AT |  A A  A A  T G  A A  G GT AT TA TA Gt A  a A  t A  a        t A  a      a  t A  a      t  t Ta        ta Ta        cg Cg        ta |  a       ta Ta        at Cg        ta At        gc At        ta Tg        tg At        gc             ttttttttattatgtttttgtgaattataccataaagtattctatactatagagtactttgtggtataattatacttgggagggataataTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1695 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_perfringens                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:69 nt.    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-15.70 kcal/mol Antiterminator:    Distance from promoter:38 nt. Size=70 nt.     Delta G= -4.90 kcal/mol Anti-antiterminator:   Size=62 nt.     Delta G= -4.30 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TAGAAA-TATTAT. It has a score value of 72.29 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TAGAAATAATTCAAATGTATAGATATTATCTTCATCAAATAACTCTTAAAAAGTTAGA GAAAAGTTTAAAGTCAGATAAAGTTAATAGTTAAtataaaaagaagttgtattcttatttagaatacagcttttt tttattatgtttttgtgaattataccataaagtattctatactatagagtactttgtggtataattatacttgggagggataataTTG     CPE0704 --- CPE0705 Gene: CPE0704     GI: 18309686     BI number: CPE0704     GOG: COG1695     Description: 30S ribosomal protein homolog Gene: CPE0705     GI: 18309687     BI number: CPE0705     GOG: -------     Description: hypothetical protei            ga           a  a           a  g   A       a  t A  A       at A  G       ag A  T       tt T  T       aa TA       t  t CG        At TA        Ac CG       |  t |  A      T  t |  A      T  a A  A      G  t A  A      A  t TG        T AT        A AT        A         t AT        T       a  t |  A       T       t  t C  A      G         ta T  A      A         cg A  G      A         ta C  T      A         ta T  C      T         at TA        A        ta CG        G        gc TA        A        ta AT       |         tg TA        C        gc TA        T        at A  A       G        at TG        A        gt AT        A        at GT        A        at                         tttattatgtttttgtgaattataccataaagtattctatactatagagtactttgtggtataattatacttgggagggataataTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1695 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................