                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:138 nt.    Distance to gene:52 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-12.00 kcal/mol
Antiterminator:    Distance from promoter:118 nt. Size=37 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGAGT-TATAAT. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGAGTTTTACTTGGTTATTTTTTATATAATTCAATAGCTAAAAAACATATTTAAattt
ttaatagagcgtatttaaataaaaagtaagactaaatatgtattagtaattttagatataaattaaaatagattagagaaaattaaaaagttgaaaataa
aagtataagttaatactttattcttgatttgaataaagtattaactttttttatttggtatttatgggttttattaggatgataaaatagaaaaaaggag
attgaaaATG

    CPE0706 Gene: CPE0706     GI: 18309688     BI number: CPE0706     GOG: -------     Description: hypothetical protei gt a  t a  a        a ta       g  t at       t  t ta       t  t gc        cg a  |       ta at        ta at        at at        ta ta        ta at        ta at        cg a  c       at at        ta gt        at tg        at ta        ta             actttttttatttggtatttatgggttttattaggatgataaaatagaaaaaaggagattgaaaATG     ..................................................................................................................