                                                                        Gene putatively regulated by attenuation in C_perfringens

This operon is putativelly rgulated by Aminoacyl-tRNA-synthetase_T-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:147 nt.    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-24.90 kcal/mol
Antiterminator:    Distance from promoter:129 nt. Size=33 nt.     Delta G= -9.01 kcal/mol
Anti-antiterminator:    Distance from promoter:91 nt.    Size=56 nt.     Delta G=-11.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaaaa-tttaat. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
The T-box sequence: agggtggtaccgcg is shown in italic-bold style

ttaaaattaagatgtacataacttttaattagattaagacgatttcctcccgttaaagaggatagaaattgagtaataagtaaggaataaatttattaaa
tttcagccatactattaaagatttctaactgaggtgagtaaaagtaattttacttattagggtggtaccgcgaagtagttccttcgtccctttttaggga
tgaaggaactttttttattaattatgctaaacacaatcaaacaatttaaatagaaaataagcaataacaaagggggccaatgtgtcATG

    CPE0710 --- aspC Gene: CPE0710     GI: 18309692     BI number: CPE0710     GOG: COG1522     Description: probable transcriptional regulator Gene: aspC     GI: 18309693     BI number: CPE0711     GOG: COG0436     Description: aspartate aminotransferas ta g  a at at at at ta gc at gt ta gt        gt gt       a  t a  a      t  c g  g       gc        tt tg        at       t  t cg        at        ta at        gc        cg |  g       cg        cg |  g       gt        cg |  t      c  |       ta |  a      c  |       gt |  c      a  |       cg |  c      t  |       ta a  g      g  |       ta t  c      g  |       cg cg       t  |       cg ta        gc        ta ta        gc        ta tg        gc        gc at        at        at                         ttttttattaattatgctaaacacaatcaaacaatttaaatagaaaataagcaataacaaagggggccaatgtgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1522 Transcriptional regulators ... can be seen here [E] COG0436 Aspartate/tyrosine/aromatic aminotransferase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Aminoacyl-tRNA-synthetase_T-box sequence ... can be seen here     ..................................................................................................................