Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:73 nt.    Distance to gene:60 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-19.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTTA-CATAAT. It has a score value of 62.92 and is shown in blue

TTGTTATGCTGCTTCAATGGAAGACATAATGGAGGCTATAAAGAGAATAAGAAGATTT
GTTGAAAGAAATAATATGCAAGGGAAATAGataaatctttttaataggtagtagaggcttaaatttagcttttactgc
cttttttaacgttaaatattttctatgtctggtgctataattgtatttaggtgggaggcgacggtcATG

    CPE0712


Gene: CPE0712     GI: 18309694     BI number: CPE0712     GOG: -------     Description: hypothetical protei


           a
         a  t
         a  t
         t  t
          ta
          cg
          gc
          gt
          at
          gt
          at
          ta
          gc
          at
          tg
          gc
          gc
          at
            tttttaacgttaaatattttctatgtctggtgctataattgtatttaggtgggaggcgacggtcATG


    ..................................................................................................................