                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:93 nt.    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-11.00 kcal/mol
Antiterminator:    Distance from promoter:52 nt. Size=52 nt.     Delta G= -5.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaat-tattat. It has a score value of 72.96 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaatacttattttaaaagatgttattatctcattaaagcagtacttaaagtaataacatctaaatttaaaacaagctattaaataatatgattatgaa
tatattacattttaaatatagatgattattatttctctactttgagtaataataatcattttttattttagttattatttaattttatctattaatttaa
tagctaatatataatataaaaaatcaaatttctaaaaggaggtatattttaATG

    CPE0737 Gene: CPE0737     GI: 18309719     BI number: CPE0737     GOG: NOG09395     Description: probable fibronectin-binding protei tt a  t c  t a  a ta ta at ta at ta a  g a  |       ct g  |      a  t ta       t  t at        cg tg        ta ta        cg at       t  t gt        ta ta        ta at        at t  |       ta a  |       ta at        at ta        ta at        ta at        at at        gc             attttttattttagttattatttaattttatctattaatttaatagctaatatataatataaaaaatcaaatttctaaaaggaggtatattttaATG     ..................................................................................................................