                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:158 nt.    Distance to gene:55 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-19.00 kcal/mol
Antiterminator:    Distance from promoter:106 nt. Size=72 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:    Distance from promoter:81 nt.    Size=52 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCAAG-TAAAAT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCAAGTTTCAATGAATAATAATATAAAATCAGCTAAAGAAATTTTAAATAGACATAA
TATAGTTGATAAAGACCAATTAAAGAAAATGAGTAAAAAATACTTTATGCCAGACTTC
TTAAATGGTGTATTTGGTAATGAAGAATATAATTTTGAAAATGAAGTAGAAATAGACT
GCGGATTATAAgagaaagctatatcaaatctttacttggtttgatatagcttttttatttaaataattatatttaatgttgacaatatcatt
aattagtgataaattaaaagcATG

    CPE0789 Gene: CPE0789     GI: 18309771     BI number: CPE0789     GOG: COG1846     Description: probable transcriptional regulato             T           A  A           A  G           A  A            GC            AT            TG            GC           |  G           |  G           A  A   A        AT A  T       GT T  G       TA G  A       AT G  A      A  A TG       A  A TA       A  g TA       G  a AT        Tg TA        Ta         a GT        Ta       t  c TA        Ta       t  t G  A      |  g      t  t G  T      A  c       cg T  |       At        tg AT        Ta        at AT        At        at AT        Ta        at TG        At        cg TA       |  c       ta |  A      |  a       at |  A      |  a       ta |  A      |  a       at |  T       At        ta CG        Gc        cg TA        At        gc TA        At        at CG        Gt        at AT        Ta        at                         tttatttaaataattatatttaatgttgacaatatcattaattagtgataaattaaaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1846 Transcriptional regulators ... can be seen here     ..................................................................................................................