                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:204 nt.    Distance to gene:21 nt.     Distance to run of Ts=2 nt.   Size=22 nt.     Delta G= -7.40 kcal/mol
Antiterminator:    Distance from promoter:139 nt. Size=72 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:    Distance from promoter:100 nt.    Size=70 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TAGAAA-AAAAAT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAGAAAAGGATGGACTAGTGAAAAAAAATGCAGATCCAGAAGATAAAAGATCTTGTAT
AATATCATTAACAGATGAAGGTAGAAAGGTTATAGAAAATATTTTACCTAGTCATATT
AATAATATTAAAAATATTTTTGAAGTTTTAACCGATGAAGAGAAAATCACATTGAAGA
ATATATTAAAAAAATTTAAAAATGTATAGtcatcaataaaaaataaaaatttttaggtatttatcactaattagtgata
aaagttgttttagataaaaagggggcaaagcaATG

    CPE0790 --- CPE0791 Gene: CPE0790     GI: 18309772     BI number: CPE0790     GOG: COG1741     Description: pirin-like protein Gene: CPE0791     GI: 18309773     BI number: CPE0791     GOG: COG1182     Description: NAD(P)H dehydrogenas   A A  A G  A AT GC        ca A  A      t  t A  |      G  c GC       A  a TA        Ta AT        At GT        Ta CG       G  a |  A      T  a |  A      A  a |  G      A  a |  A      A  a |  A      A  | |  T       At |  A       Ta |  T       Ta C  A       Ta AT       A  a AT       A  a TA        At TA        At TA        At TA        At |  A       At |  A       Ta G  A       Tg AT       A  |       at AT        Tg       a  t GT        At        ta TA        Ta        cg TA        At        at TA        At        cg TA        Gt        ta TA       A  a       at AT        At        ta TG        Gc        ta AT        Ta        ta                         agttgttttagataaaaagggggcaaagcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1741 Pirin-related protein ... can be seen here [I] COG1182 Acyl carrier protein phosphodiesterase ... can be seen here     ..................................................................................................................