                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:32 nt.    Distance to gene:132 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G= -8.30 kcal/mol
Antiterminator:    Distance from promoter:22 nt. Size=23 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGTA-TAATTT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGTACAGTTGTATTTTCGTTAATTTTTTTATTAGAACAACCTATAAATAGGCTTAC
AACTACTAAGCTTGATAAAGCTATAGATAGTAATTTTTTTTTCATacttaaaacctccaaataatta
tttttttgtcgaatgatgtagaaaaactaatgagtttatgatatcataaatgataaagattatcaatattaaataaaagtatttatcttttaagatggag
gaagtatATG

    CPE0793 --- CPE0794 --- CPE0795 Gene: CPE0793     GI: 18309775     BI number: CPE0793     GOG: COG0609     Description: probable iron(III) dicitrate ABC transporter Gene: CPE0794     GI: 18309776     BI number: CPE0794     GOG: COG0609     Description: probable iron(III) dicitrate ABC transporter Gene: CPE0795     GI: 18309777     BI number: CPE0795     GOG: COG1120     Description: probable iron(III) dicitrate ABC transporte            AT           G  A            TA            TA   C        CG A  T       GC A  A       AT C  C      |  A AT        AT TA        TA TA        CG CG       |  A GC        AT GT        TA AT        CG TG        AT             AATTTTTTTTTCATacttaaaacctccaaataattatttttttgtcgaatgatgtagaaaaactaatgagtttatgatatcataaatgataaagattatcaatattaaataaaagtatttatcttttaagatggaggaagtatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here     ..................................................................................................................