                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:88 nt.    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-14.10 kcal/mol
Antiterminator:    Distance from promoter:23 nt. Size=76 nt.     Delta G= -4.14 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -3.74 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaata-tatatt. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaataattatataatttatttttgtatattattggcttttagattattcaaaatggatttacatataaagtatttagatgtaaaataaaattataatat
taaaatgcagatgattattaggggagtttagggaataaactcccttcttttttgtatttatggatatattaatttcattaaaggggtgaagatATG

    CPE0796 Gene: CPE0796     GI: 18309778     BI number: CPE0796     GOG: COG0494     Description: MutT/nudix family protei            aa           a  a           t  t           a  t           a  a           a  t           a  a            ta            gt            ta            at   a        gt a  a      a  a a  t       ta cg        ta tg        ta ta        at at        tg |  t       gc |  t      |  a t  a      |  g t  c      |  a a  a      |  t g  t      |  g a  a      a  a t  t       at ta        at ta        ta         g ta        at       g  a cg       |  t      g  a gt       t  a       at |  a      a  g       ta g  t      c  g       ta t  t      a  g       ta t  t       tg        gc a  a       ta        at tg        tg        gc ta        at        gc at        gt        gc tg        gt        gt at        ta        at                         cttttttgtatttatggatatattaatttcattaaaggggtgaagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [LR] COG0494 NTP pyrophosphohydrolases including oxidative damage repair enzymes ... can be seen here     ..................................................................................................................