                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:106 nt.    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-15.30 kcal/mol
Antiterminator:    Distance from promoter:73 nt. Size=72 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:    Distance from promoter:51 nt.    Size=52 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTTAA-TATATT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTTAAATACTTCATTTATAAAGTATATTATAAACATAGGAATGTCTTTAGCTTTTTC
ATTAGGAATGACAGAAGCTATAGTATTTTGTATGGCTGGTATAGTAAGAATTATGGAA
GAGAATAAAGAAATATAAaaaaatgcttcacaattttgtgaagcattttttatttatatgattttttatacagaaataaaattaaaa
tagcattatttggtataattaactttgttaaaatgtgaaaaattacagagaggtttttATG

    CPE0802 --- CPE0803 Gene: CPE0802     GI: 18309784     BI number: CPE0802     GOG: COG1451     Description: hypothetical protein Gene: CPE0803     GI: 18309785     BI number: CPE0803     GOG: COG1451     Description: hypothetical protei            aa           A  a            Aa            Ta            At            Tg            Ac            At           A  t           G  c            Aa            Ac AG       |  a A  A      A  a TA       T  t GT        At AT        At TA        G AT       | TG       A G  G       G G  A       A TA        A CG        G |  A       G        tt G  G       T       a  t G  A       A        at TA       |         cg AT       |         at TA       |         cg |  A      |         ta G  A      T         ta TG       T         cg TA       A         gc TA       A         ta TA        G        at AT        A        at TA        A        at GT        T        at                         ttatttatatgattttttatacagaaataaaattaaaatagcattatttggtataattaactttgttaaaatgtgaaaaattacagagaggtttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1451 Predicted metal-dependent hydrolase ... can be seen here [R] COG1451 Predicted metal-dependent hydrolase ... can be seen here     ..................................................................................................................