                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:118 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-18.80 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCTGGACTTGCAGGATTATTATTAACATTCCTTTGTATGTGGTTACTTAAGAAGAAA
GTATCTCCAATTGTAATTATTCTTGCTTTATTCGCAATCGGTATTGTTTTCCACGTAA
TAGGATTAATGTAAtatttttatttagcctaggttagtataatattttacttagcctaggcttttcttaaaaataaaaaggataaaagag
cctttataaaaaattttcataagaactatttattttgaaaagaaatacttaagcaaaataagtttatatatttaattagaaaagaggtagatctATG

    CPE0825 Gene: CPE0825     GI: 18309807     BI number: CPE0825     GOG: COG4687     Description: conserved hypothetical protei   t a  t t  t At At Ta        ta Gt       a  t T  |      a  t At       t  t At        at Ta        ta Tg        gc A  |      |  t Gc        at Gc        ta At        tg Ta        gc |  g       gc A  g       at A  t       ta T  t       cg G  a       cg Cg        gc At        at             tttcttaaaaataaaaaggataaaagagcctttataaaaaattttcataagaactatttattttgaaaagaaatacttaagcaaaataagtttatatatttaattagaaaagaggtagatctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4687 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................