                                                                        Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:64 nt.    Distance to gene:149 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -7.00 kcal/mol
Antiterminator:    Distance from promoter:19 nt. Size=55 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttcaat-tataat. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcaataaataaggaaacaacagtttatataatgtgtcagagataacaattcctagtaatcttttttataaaaattccataaaggagaaataaaaaggtt
gtataagttaatttaactttgcaaccttttttagttgtttttaaattggagatttaaaaatgaaataaaaactataaatatattttgaggattatcccta
agttcaaaatatataacattgacaattgtcgatatataattataatgaaatatagttataaaaagttttagtattaggaagtgaagaaatATG

    CPE0837 Gene: CPE0837     GI: 18309819     BI number: CPE0837     GOG: COG0640     Description: probable transcriptional regulato             a           t  a           a  a            cg            cg            ta            tg           a  a           a  a           a  |           a  | tc       a  | t  c       ta a  t       at a  a       ta cg        ta         t at        ta       a  t a  a       ta        at ta        ta        ta at        tg        ta gc        cg        gc at       |  t       at gt       t  t       at at       a  g      t  | c  t       at        at t  t       ta        tg gt        gt        gc ta       a  a       ta gt        ta        ta ta        cg        gc                         cttttttagttgtttttaaattggagatttaaaaatgaaataaaaactataaatatattttgaggattatccctaagttcaaaatatataacattgacaattgtcgatatataattataatgaaatatagttataaaaagttttagtattaggaagtgaagaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0640 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_perfringens                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:62 nt.    Distance to gene:159 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-11.90 kcal/mol Antiterminator:    Distance from promoter:31 nt. Size=55 nt.     Delta G= -7.70 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttcaat-tataat. It has a score value of 60.91 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttcaataaataaggaaacaacagtttatataatgtgtcagagataacaattcctagtaatcttttttataaaaattccataaaggagaaataaaaaggtt gtataagttaatttaactttgcaaccttttttagttgtttttaaattggagatttaaaaatgaaataaaaactataaatatattttgaggattatcccta agttcaaaatatataacattgacaattgtcgatatataattataatgaaatatagttataaaaagttttagtattaggaagtgaagaaatATG     CPE0837 Gene: CPE0837     GI: 18309819     BI number: CPE0837     GOG: COG0640     Description: probable transcriptional regulato   a a  a t  a aa ag ag gt a  t g  g g  | a  | a  | at ta         t at       a  t ca        at ca        ta tg        ta tt        gc at        at aa        at |  a      t  | a  t       at a  t       tg at        gc t        ta a        ta t         gc t        gc t        at             tttttagttgtttttaaattggagatttaaaaatgaaataaaaactataaatatattttgaggattatccctaagttcaaaatatataacattgacaattgtcgatatataattataatgaaatatagttataaaaagttttagtattaggaagtgaagaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0640 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................