Gene putatively regulated by attenuation in C_perfringens
Characteristics of the secondary structures
Terminator: Distance from promoter:153 nt. Distance to gene:34 nt. Distance to run of Ts=0 nt. Size=30 nt. Delta G=-11.90 kcal/mol
Antiterminator: Distance from promoter:104 nt. Size=65 nt. Delta G= -7.00 kcal/mol
Anti-antiterminator: Distance from promoter:83 nt. Size=56 nt. Delta G= -5.30 kcal/mol
Nomenclature/Definitions
The most likely promoter is: TTGATA-TAAAGT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TTGATATATTAAATGGAAAAGGTGATAAAGTTTTAAAAAGCTTTAAGGAAGTTACTAT
AAAGGGTAAAAAAGTTAAAATACAAAAAGCAAGAAAATAAaattattattaatttaattataaaagtagt
tataatgttaaattgttttgaagtatataatgaccatgtaatatgtggtaaaattaaagtaagatatagtaaaatatatcttactttttttaaaaggaaa
ttttatttttgagaggtggtctgtATG
CPE0863
Gene: CPE0863 GI: 18309845 BI number: CPE0863 GOG: ------- Description: hypothetical protei
a
a t
ta
gt
tg
tg at
t t cg
at cg
at at
at g a
tg t a
ta a a
| a a a
g g t t
t t a |
a a t |
at at
ta ta
at g a
ta a a aa
ta a g t a
gt gt g a
a g ta at
ta ta ta
gc tg at
a c ta ta
a a gt at
a | ta gc
at t t at
tg a a at
at a g ta
ta at gc
ta ta at
at ta at
tttttaaaaggaaattttatttttgagaggtggtctgtATG
..................................................................................................................