Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:104 nt.    Distance to gene:103 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-12.80 kcal/mol
Antiterminator:    Distance from promoter:43 nt. Size=68 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:    Distance from promoter:19 nt.    Size=32 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTGACA-TAGAAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGACAAACTAGGGAAAAACAAACTAATAGAATATACTTATATACCAGGAACTTATAT
CGATTCTGAAAAGTTAAAAGATATGGAAGTTATAAATGGAAATTATTATTATGCAAAT
GATAATTTAGTTTAGattttaaagctctaagtttaaaacttagggctttttttaattaagaattaatttaaaaataaaaatattaataa
aattgctttaatattcatatattgttaaatttaaacacatattataagttagtacagagtgctataATG

    CPE0864


Gene: CPE0864     GI: 18309846     BI number: CPE0864     GOG: COG0534     Description: conserved hypothetical protei


            G
          T  C
          A  A
           TA
           TA
           AT
           TG
           TA
           AT
           TA
           TA
           AT
           AT
           AT
          G  A
          G  |
           TG
           AT
           AT
 AA        AT
G  A       TA
 TA       A  |
 CG        TG         a
|  T       Ta       t  a
|  T       Gt        ta
T  A       At        ta
T  A       At        gc
A  A       Gt        at
G  A      |  a       at
 CG       G  a       ta
 TA       T  a       cg
 AT       A  g       tg
 TA       T  c       cg
 AT        At        gc
 TG        Gc        at
 TG        At        at
                        tttttaattaagaattaatttaaaaataaaaatattaataaaattgctttaatattcatatattgttaaatttaaacacatattataagttagtacagagtgctataATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[V] COG0534 Na+-driven multidrug efflux pump ... can be seen here

    ..................................................................................................................