Gene putatively regulated by attenuation in C_perfringens
Characteristics of the secondary structures
Terminator: Distance from promoter:105 nt. Distance to gene:63 nt. Distance to run of Ts=0 nt. Size=39 nt. Delta G=-10.72 kcal/mol
Antiterminator: Distance from promoter:72 nt. Size=48 nt. Delta G= -4.10 kcal/mol
Anti-antiterminator: Distance from promoter:50 nt. Size=38 nt. Delta G= -4.27 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttaata-taattt. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttaatacgtttacattataattctaattttagaccaaatcaagcttttttcaaaaaaatagttatttttatccataataaagaggaaaactttaaatata
atatttctccccctcttaaatttattgattataaagaatcttagaaataatatttaatattttttaagattcttttttatgtatatttttcttattactg
tcaataatctcagtataaattcatattaggagggctattaaATG
CPE0886
Gene: CPE0886 GI: 18309868 BI number: CPE0886 GOG: ------- Description: hypothetical protei
at
t t
tg
ta
at
at t
at | a t t
t a | t a a
a a a a t a
a t ta a t
a a ta a a
t t cg t t
t t ta at
t t c a at
c c c t at
a t c c gt
a c c t at
a c c t ta
a c ta ta
gc cg cg
gc ta ta
at ta at
gc ta at
at at gc
at ta at
tttttatgtatatttttcttattactgtcaataatctcagtataaattcatattaggagggctattaaATG
..................................................................................................................