Gene putatively regulated by attenuation in C_perfringens

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:72 nt.    Distance to gene:127 nt.     Distance to run of Ts=2 nt.   Size=36 nt.     Delta G=-12.20 kcal/mol
Antiterminator:    Distance from promoter:34 nt. Size=43 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:    Distance from promoter:1 nt.    Size=54 nt.     Delta G= -3.81 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaaaa-gatatt. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaaaaaataagttagagtgtgtgatattttcatataactttatagcttagattaagcaatagtttttttaaaattaaatatggtaattttatttatgta
gaaaaaaggtggattaaagaacttatccatctttttttatattttatgataattaaattaaaaataataaatatttattaataatctttctaaattttta
attgacttttaatgaattgtatagtattattctaaatgaaaatgattgtcagtaacatatggaaggagaaatcaATG

    CPE0938


Gene: CPE0938     GI: 18309920     BI number: CPE0938     GOG: COG2717     Description: hypothetical protei


  a
g  t
 at
 ta
 ta
 cg
 gc
a  a
t  a
a  t
t  |
t  |
 ta         a
 cg       t  a
 at       g  t
 at       g  t
|  t      t  t
|  t       at        ga
|  t       ta       a  a
|  t       at       a  c
|  t       at       a  t
|  a       at       t  t
|  a       ta        ta
|  a      t  t       at
|  a      a  g       gc
|  t      a  |       gc
|  t      a  |       ta
|  a       at        gt
|  a       ta        gc
 ta        tg        at
 at        ta        at
 ta        ta        at
 at        ta        at
 cg        ta        at
 tg        ta        at
                        tatattttatgataattaaattaaaaataataaatatttattaataatctttctaaatttttaattgacttttaatgaattgtatagtattattctaaatgaaaatgattgtcagtaacatatggaaggagaaatcaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG2717 Predicted membrane protein ... can be seen here

    ..................................................................................................................